
Hlavná stránka Vyhľadávanie Diskusné fórum Antikvariát Výstavy a predajné stretnutia ("burzy")LiteratúraHerpetofauna SRVivaristika na známkachŽabčonoviny

Články a iné

TeraristikaAkvaristikaReportážeNápady pre VásZo svetaAktuality Fotogaléria




Na SlovenskuV ČecháchVšeobecneOficiálne stránky


Kontakt Linky Naše bannery Reklama

Vesmír 2022/6


Šifra opata Gregora
Ondřej Vrtiška
„GCCTATTCCAGGTATGGGTTTGCC…“ Kdybyste předchozí řádek ukázali Gregoru Johannu Mendelovi nebo kterémukoli z jeho současníků, zíral by na vás dost...

Malé družice demokratizují poznávání vesmíru
Josef Tuček
Norbert Werner, rodák z východoslovenské Rožňavy, přednášel v Evropě, Americe i Asii. Se studenty si vzájemně tyká. Jako první pozoroval vlákna...


Slavný všude, jen ne u nás
Marek Vácha
„Nikdy si nepsal deník a jeho dopisy vrhají na jeho vnitřní život jen málo světla. Jakožto kněz musel být obzvláště obezřelý při vyjádření svých...

G. J. Mendel pohledem antropologie a genetiky
Eva Drozdová, Michael Doubek, Šárka Pospíšilová
Na výzkumu ostatků Gregora Johanna Mendela (1822–1884), iniciovaném u příležitosti blížícího se dvoustého výročí narození tohoto významného...

Umožní editace genomů nasytit lidstvo?
Vojtěch Hudzieczek, Roman Hobza, Petr Cápal, Jan Šafář, Eduard Kejnovský, Jaroslav Doležel
Od objevu zákonů dědičnosti augustiniánským mnichem Gregorem Johannem Mendelem roku 1866 učinila genetika velký pokrok. Pochopili jsme fungování...

Ovlivníme myšlenkami naši DNA?
Eduard Kejnovský
Když Gregor Mendel objevil a popsal zákony dědičnosti, nevěděl nic o nositelce dědičné informace, molekule DNA. S dnešními znalostmi genetiky je...

Náhradní díly z prasete
Jaroslav Petr
Pátek 7. ledna 2022 se navždy zapsal jako den, kdy v těle člověka začalo bít první geneticky modifikované prasečí srdce. Šlo o prozatím poslední...

Hledat a lépe poznat ložiska nerostných surovin
Graham Hill, Jochen Kamm, Maxim Smirnov
Dobré tipy jsou nad zlato. V případě nerostných surovin to může být sofistikovaná kombinace regionálních magnetotelurických a seismických dat.

Nejstarší Evropanka
Rebeka Rmoutilová, Petr Velemínský, Jaroslav Brůžek
Ve čtvrtek 14. září 1950 se v lomu pod návrším Zlatý kůň u Berouna chystají k odstřelu vápence. Je určen pro výrobu cementu. Zahřmí výbuch...

Jak uchovávat energii
Jiří Čermák, Lubomír Král, Pavla Roupcová
Vědce a techniky, kteří se zabývají problémem uskladnění energie, trápí nerudovská otázka „kam s ní“. A jak ji uložit, aby se v případě potřeby...

Proměnlivost bakteriálních kolonií
Jaroslav Čepl, Anna Blahůšková, Anton Markoš
„Za přísně definovaných a dodržovaných laboratorních podmínek si živá bytost dělá, co chce.“ Zdeněk Neubauer z toho v sedmdesátých letech vyvodil...

Vojtěch Vincenc Zarda
Petr Šíma
Je dobrým zvykem připomínat si osobnosti, které svými myšlenkami a skutky předstihly svou dobu. Takovou zapomenutou osobností je i MUDr. Adalbert...

Je-li tam život taky?
Petr Kabáth
V Písních kosmických sedí žáby v kaluži, poslouchají žabákův výklad o vesmíru a ptají se ho, hledíce k obloze, „jsou-li tam žáby taky“. Nás lidi...

Krajina po bitvě
Jaroslav Kukla
Krajinu u Verdunu za první světové války „přeoraly“ miliony dělostřeleckých granátů a změnily ji k nepoznání. Půdu kontaminovala rezidua výbušnin,...

Prolévat luteránskou krev
Petr Vorel
Když se řekne „křížová výprava“, vybaví si čtenář nejspíš tažení středověkých rytířů k Božímu hrobu do Palestiny. Anebo zbabělé křižáky, prchající...


Města plná života
Marek Janáč
Přes 67 tisíc lidí z 445 měst z celého světa se na přelomu dubna a května zúčastnilo sedmého ročníku kampaně City Nature Challenge. Během...

Ropucha se kouše do vlastního ocasu
Pavel Pipek
Dospělé žáby pochopitelně nemají ocasy, pulci však ano. A právě pulce vlastního druhu začala ve velké míře konzumovat invazní ropucha obrovská...

Brhlíku, důvěřuj, ale prověřuj!
Ondřej Fišer
Kdo by neznal modře opeřeného stromolezce s tajemnou páskou přes oko. Brhlíci jsou vynikajícími lezci po kmenech a jako jediní ptáci na světě to...

Příjemné doteky
Radkin Honzák
Člověk potřebuje několik pohlazení denně, jinak mu vysychá mícha. To řekl před více než půlstoletím zakladatel transakční analýzy Eric Berne....

Přepólování magnetického pole aktivního galaktického jádra v „živém“ přenosu
Ivan Boháček
Plyny a prach padající do černé díry v jádrech galaxií vytvářejí kolem nich akreční disk. V něm se různými procesy zahřívají a jsou zdrojem záření...


Porozumět dialogu mezi mozkem a srdcem
František Vyskočil
V biomedicíně stále přibývá informací o každém orgánu a systému. Jistě je to nezbytná tendence zaměřovat se ve výzkumu i léčení na stále užší...

Emoce, pravopis a rusko
Hana Dufková
Velvyslanec Ukrajiny v ČR Jevhen Perebyjnis napsal v tweetu ze 17. dubna 2022: „Ne, psaní slova rusko s malým písmenem „r“ není chyba. Je to odraz...

„Rakovina“ betonu
Ivan Boháček
Tímto hovorovým termínem někdy označují materiáloví vědci důsledky reakcí alkalických iontů a oxidu křemičitého v roztocích v pórech betonu....

Nová výbušnina trhá staré rekordy
Jan Havlík
Většina klasických výbušnin, jako je například trinitrotoluen (TNT), využívá chemického spojení organických nitroskupin bohatých na kyslík...

Která strana je nejbohatší?
Miroslav Zeidler
Bohatost rostlinných společenstev v nehostinných oblastech souvisí nejen s klimatickými podmínkami, ale i s lokální topografií, především...

Najskôr svaly, potom dôvtip
Peter Mikula
Cicavce sú najencefalizovanejšou líniou vertebrát (t. j. majú najväčší pomer medzi veľkosťou mozgu a tela). Dlho sa predpokladalo, že vysoká...

4000 km2
Ondřej Vrtiška
Mezi roky 1999 a 2019 na celém světě zaniklo asi 13 700 km2 pobřežních mokřadů. Zároveň jich však asi 9700 km2 vzniklo, takže čistá ztráta se...

Pásovci v blízkosti lidí mění své chování
Ivan H. Tuf
Vliv lidské činnosti na okolní prostředí je nepopiratelný, byť občas není příliš zjevný. Příkladem mohou být pásovci devítipásí (Dasypus...

Pulčí polévka
Oldřich Nedvěd
Že Francouzi jedí žáby, je všeobecně známo. Ale konzumace pulců dosud nebyla řádně doložena. V Mexiku však nyní zdokumentovali přípravu polévky...


Hyperuniformní neuspořádaná textura
Ivan Boháček
Účinnost tenkých fotovoltaických článků lze zvýšit úpravou jejich povrchu. Od křemíkových vrstev o tloušťce zhruba 1 mikrometru se většina světla...

Neinvazivní testování rakoviny kůže
Ivan Boháček
Levné a malé (ruční) zařízení využívající k zobrazení kožních nádorů milimetrových vln by se brzy mohlo stát běžným vybavením ambulance...

Životnost baterií
Ivan Boháček
Jizhou Li se spolupracovníky získali pomocí rentgenové tomografie trojrozměrné snímky katod lithium-iontových baterií po 10 a po 50 cyklech...


75 %
Ondřej Vrtiška
Má-li Země i v budoucnu uživit rostoucí lidskou populaci, konzumace masa v bohatých zemích musí klesnout nejméně o 75 %. Tvrdí to studie dvou...

„Náš“ Ivan Boháček v dobré společnosti
Ondřej Vrtiška
Učená společnost České republiky udělila Ivanu Boháčkovi z redakce Vesmíru medaili za zásluhy o rozvoj vědy. Ivan Boháček působí ve Vesmíru...

V Ondřejově testují Čerenkovovy teleskopy
Ondřej Vrtiška
Na pozemku Astronomického ústavu AV ČR v Ondřejově pracují ve vzdálenosti 190 metrů od sebe dva prototypy Čerenkovových teleskopů, které pátrají...

Parazit do každé rodiny
Ondřej Vrtiška
Druhová jména organismů často vycházejí z jejich vzhledu či vlastností, obvyklé je i pojmenování po významných vědcích. Výjimkou není ani...


Smrk v našich lesích
Ondřej Vrtiška
1952: Jedním z problémů, jež naše lesnictví dnes řeší, je otázka smrku. Smrk je již dlouhou dobu nejrozšířeněiší dřevinou v českých a moravských...

Wszechświat (Vesmír)
Ondřej Vrtiška
1882: Týdenník populární věnovaný naukám přírodnickým počal vycházeti ve Varšavě péčí redakčního komitétu dra T. Chałubińskiho, mag. K. Deika, dra...


Světová výstava v časech krize
Shota Tsikoliya
Světová výstava 2020 v Dubaji se původně měla konat na přelomu let 2020 a 2021, avšak kvůli pandemii covidu-19 byla posunuta o rok a proběhla...

Rychlost rozpínání vesmíru
Jiří Svoboda
ad Vesmír 101, 209, 2022/4 Na začátku odpovědi na dotaz čtenáře Víta Němečka se píše „Protože se vesmír rozpíná, a podle současných poznatků se...

Viditelná oblast vesmíru
Jiří Svoboda
ad Vesmír 101, 209, 2022/4 V odpovědi na čtenářův dotaz mne zaujalo: „Před zmiňovanými 13 miliardami let byla oblast velká přibližně 100 milionů...

Písnička o krokodýlovi
Jiří Tučan
ad Vesmír 101, 314, 2022/5 Hned v úvodu zajímavého článku mne upoutala zmínka o písničce „Po řece Vltavě plave krokodýl“. Znám ji. Babička nás ji...


Olga Stehlíková: Mojenka
Eva Bobůrková
Maminka Magdalény, Mojenky, je přírodovědkyně. A své dceři vypráví zajímavosti ze světa přírody, zejména stromů, středočeských lesů, přivádí ji...

Jitka Klimešová: Těla rostlin
Ondřej Vrtiška
Botanik Bohumil Němec (mimo jiné v letech 1923–1945 šéfredaktor Vesmíru) napsal v roce 1937 knihu Duše rostlin. Jitka Klimešová z Botanického...

| Vytlačiť článok |

Šéfredaktor | 24.6.2022 00:03 | 0 komentárov | 116x